ID: 1044031755_1044031757

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1044031755 1044031757
Species Human (GRCh38) Human (GRCh38)
Location 8:87247012-87247034 8:87247045-87247067
Sequence CCATAATCTCGTTTTGGTTACTG AAACTCTGCTTCACAAAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 22, 3: 16, 4: 106} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!