ID: 1044093635_1044093640

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1044093635 1044093640
Species Human (GRCh38) Human (GRCh38)
Location 8:88033996-88034018 8:88034024-88034046
Sequence CCTATCAACAGGCAATACCCATC CAGCATTTCACTTTTCTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120} {0: 1, 1: 0, 2: 0, 3: 30, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!