ID: 1044110453_1044110461

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1044110453 1044110461
Species Human (GRCh38) Human (GRCh38)
Location 8:88266569-88266591 8:88266597-88266619
Sequence CCATTTGGCGTCCCCATTTTCCT CCCTCCTACTTTGGTAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 215} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!