ID: 1044125796_1044125807

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1044125796 1044125807
Species Human (GRCh38) Human (GRCh38)
Location 8:88457049-88457071 8:88457087-88457109
Sequence CCACCCAAGCTCTCTAGCCAACA CCTGGAATGGCGCTCCCAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 39, 3: 103, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!