ID: 1044127316_1044127328

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1044127316 1044127328
Species Human (GRCh38) Human (GRCh38)
Location 8:88474388-88474410 8:88474432-88474454
Sequence CCCCCAGGACCCCAGCCTGGTCA CTGTACCAGCAGAAGCAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 47, 4: 512} {0: 1, 1: 0, 2: 2, 3: 24, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!