ID: 1044259281_1044259291

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1044259281 1044259291
Species Human (GRCh38) Human (GRCh38)
Location 8:90098547-90098569 8:90098585-90098607
Sequence CCTTCCTGCAGCCCTCTAGGGTG CCCAGGTCCTGCGCCTAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 22, 3: 62, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!