ID: 1044277690_1044277695

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1044277690 1044277695
Species Human (GRCh38) Human (GRCh38)
Location 8:90321599-90321621 8:90321617-90321639
Sequence CCAGAATGTACAAGTAGCTGGGC TGGGCGGGAGAACACTGTAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 13, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!