ID: 1044282400_1044282409

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1044282400 1044282409
Species Human (GRCh38) Human (GRCh38)
Location 8:90371333-90371355 8:90371376-90371398
Sequence CCTCCTTCAACACCCACATTGCC ACATCTAGCAGCCTGACCTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!