ID: 1044319982_1044319987

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1044319982 1044319987
Species Human (GRCh38) Human (GRCh38)
Location 8:90791318-90791340 8:90791333-90791355
Sequence CCCGCCTTTGGGGAAGGTCGGGC GGTCGGGCAGACAGGCCACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!