ID: 1044391748_1044391759

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1044391748 1044391759
Species Human (GRCh38) Human (GRCh38)
Location 8:91660617-91660639 8:91660669-91660691
Sequence CCTCAGCTAAGGACAGCCACCTT CCTCATCTGCAGACTGAGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!