ID: 1044416866_1044416879

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1044416866 1044416879
Species Human (GRCh38) Human (GRCh38)
Location 8:91948972-91948994 8:91949003-91949025
Sequence CCCTCAACCCCTTCTTCACCCTG GTCCCGCTTTCCTGGGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 13, 3: 44, 4: 478} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!