ID: 1044468311_1044468316

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1044468311 1044468316
Species Human (GRCh38) Human (GRCh38)
Location 8:92534343-92534365 8:92534356-92534378
Sequence CCACAGTGTCTTTTCCAAGGCTT TCCAAGGCTTTGGGGGCAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 30, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!