ID: 1044533350_1044533356

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1044533350 1044533356
Species Human (GRCh38) Human (GRCh38)
Location 8:93332967-93332989 8:93333004-93333026
Sequence CCTAGAAAGAAGACCAAGAAAAG AGGAAGAAACAAAATGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 19, 3: 277, 4: 2747}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!