ID: 1044542380_1044542386

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1044542380 1044542386
Species Human (GRCh38) Human (GRCh38)
Location 8:93422351-93422373 8:93422367-93422389
Sequence CCCACATTCCACATGCCTTAGAA CTTAGAATATGTCAGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 164} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!