ID: 1044556896_1044556898

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1044556896 1044556898
Species Human (GRCh38) Human (GRCh38)
Location 8:93572475-93572497 8:93572505-93572527
Sequence CCTTTTACAATCTCTGAGAACAC AAACTCCCAACTGTGAAGCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!