ID: 1044569399_1044569404

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1044569399 1044569404
Species Human (GRCh38) Human (GRCh38)
Location 8:93700556-93700578 8:93700575-93700597
Sequence CCGGCGGCTGCTTGCGCCCCAGC CAGCGCGCGCCCAGGCGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 223} {0: 1, 1: 0, 2: 2, 3: 10, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!