ID: 1044569424_1044569432

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1044569424 1044569432
Species Human (GRCh38) Human (GRCh38)
Location 8:93700632-93700654 8:93700679-93700701
Sequence CCGTGCGCGAGGCAGCATGATGA AGCCCGAGCCCAGCTGCCCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 70} {0: 1, 1: 2, 2: 19, 3: 48, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!