ID: 1044569429_1044569441

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1044569429 1044569441
Species Human (GRCh38) Human (GRCh38)
Location 8:93700662-93700684 8:93700696-93700718
Sequence CCTGGAAAACCGGTAACAGCCCG CCAGGGCCGCCCACACTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 49} {0: 1, 1: 0, 2: 0, 3: 20, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!