ID: 1044569430_1044569439

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1044569430 1044569439
Species Human (GRCh38) Human (GRCh38)
Location 8:93700671-93700693 8:93700695-93700717
Sequence CCGGTAACAGCCCGAGCCCAGCT CCCAGGGCCGCCCACACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 121} {0: 1, 1: 0, 2: 1, 3: 36, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!