ID: 1044569435_1044569445

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1044569435 1044569445
Species Human (GRCh38) Human (GRCh38)
Location 8:93700687-93700709 8:93700702-93700724
Sequence CCCAGCTGCCCAGGGCCGCCCAC CCGCCCACACTGGAGGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 376} {0: 1, 1: 0, 2: 7, 3: 308, 4: 6689}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!