ID: 1044569436_1044569450

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1044569436 1044569450
Species Human (GRCh38) Human (GRCh38)
Location 8:93700688-93700710 8:93700714-93700736
Sequence CCAGCTGCCCAGGGCCGCCCACA GAGGGCTGGGGTGAGGGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 426} {0: 1, 1: 2, 2: 27, 3: 317, 4: 2780}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!