ID: 1044591298_1044591318

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1044591298 1044591318
Species Human (GRCh38) Human (GRCh38)
Location 8:93916812-93916834 8:93916856-93916878
Sequence CCCCGCCCCACCCCCGGCCGCAG CTCGTCACTGCGCAGCCAATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 181, 4: 1696} {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!