ID: 1044591307_1044591323

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1044591307 1044591323
Species Human (GRCh38) Human (GRCh38)
Location 8:93916825-93916847 8:93916875-93916897
Sequence CCGGCCGCAGCCCTCTCCGCCTC TCGGCAGGCGGGAAGCACTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 658} {0: 1, 1: 0, 2: 1, 3: 4, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!