ID: 1044591309_1044591324

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1044591309 1044591324
Species Human (GRCh38) Human (GRCh38)
Location 8:93916835-93916857 8:93916888-93916910
Sequence CCCTCTCCGCCTCCCCTCCCACT AGCACTCCGGCCCGAACGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 251, 4: 1896} {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!