ID: 1044591311_1044591320

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1044591311 1044591320
Species Human (GRCh38) Human (GRCh38)
Location 8:93916841-93916863 8:93916863-93916885
Sequence CCGCCTCCCCTCCCACTCGTCAC CTGCGCAGCCAATCGGCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 93, 4: 1009} {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!