ID: 1044618180_1044618183

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1044618180 1044618183
Species Human (GRCh38) Human (GRCh38)
Location 8:94163504-94163526 8:94163524-94163546
Sequence CCTTGCTCCTTTGGGGGATGCTC CTCCCCTCCCTGGCTCCTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 79, 4: 586}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!