ID: 1044635549_1044635556

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1044635549 1044635556
Species Human (GRCh38) Human (GRCh38)
Location 8:94320193-94320215 8:94320243-94320265
Sequence CCAATGAAAAGTCCTGCAATCAC ATTCTCTCTCCATGCCACAGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 13, 3: 100, 4: 285} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!