ID: 1044709109_1044709116

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1044709109 1044709116
Species Human (GRCh38) Human (GRCh38)
Location 8:95038462-95038484 8:95038513-95038535
Sequence CCAGGCCCGGGTAGCTGGGGCTA GTTTTTTTAATTTTTAGTACAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 45, 3: 572, 4: 6166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!