ID: 1044716278_1044716285

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1044716278 1044716285
Species Human (GRCh38) Human (GRCh38)
Location 8:95102646-95102668 8:95102678-95102700
Sequence CCATGGGTACCTGAGGGAGGTGC CTGCTGGTACTGAAGGAGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!