ID: 1044719851_1044719870

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1044719851 1044719870
Species Human (GRCh38) Human (GRCh38)
Location 8:95134299-95134321 8:95134337-95134359
Sequence CCGCCGCCGCCGCGGGGGGACGG GTCCGGTCCACGGGTCTGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 299} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!