ID: 1044727042_1044727047

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1044727042 1044727047
Species Human (GRCh38) Human (GRCh38)
Location 8:95202434-95202456 8:95202484-95202506
Sequence CCAAGAGTACTGAACCCTATATA TCTTTTTTTTAATAGAGATAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 7, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!