ID: 1044875955_1044875959

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1044875955 1044875959
Species Human (GRCh38) Human (GRCh38)
Location 8:96666561-96666583 8:96666578-96666600
Sequence CCTAAAGAAAATAAAGCCAGAAC CAGAACATGGGAAAGTATGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!