ID: 1044930257_1044930268

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1044930257 1044930268
Species Human (GRCh38) Human (GRCh38)
Location 8:97245291-97245313 8:97245323-97245345
Sequence CCCCCTTCCCTTCATTCCCCCAG CACACCTCTCACGCTCTAGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 137, 4: 1217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!