ID: 1044952959_1044952963

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1044952959 1044952963
Species Human (GRCh38) Human (GRCh38)
Location 8:97451442-97451464 8:97451460-97451482
Sequence CCTTCCCACAACACAGAAGGGAG GGGAGAGTACATATTTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 242} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!