ID: 1045002216_1045002227

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1045002216 1045002227
Species Human (GRCh38) Human (GRCh38)
Location 8:97888263-97888285 8:97888293-97888315
Sequence CCAAAAGTGGGCAGGTGGGGGTG GAGGGCTCAGGGACAGGGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 286} {0: 1, 1: 0, 2: 5, 3: 60, 4: 615}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!