ID: 1045019801_1045019805

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1045019801 1045019805
Species Human (GRCh38) Human (GRCh38)
Location 8:98032136-98032158 8:98032150-98032172
Sequence CCTTAGGTTATGGCAGGTAGGTA AGGTAGGTAAGGAGGTGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 55} {0: 1, 1: 0, 2: 4, 3: 29, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!