ID: 1045036248_1045036254

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1045036248 1045036254
Species Human (GRCh38) Human (GRCh38)
Location 8:98178581-98178603 8:98178620-98178642
Sequence CCATCTTTCCACCAAGAAGCACC ATCCACCTGTAAGCCCATGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!