ID: 1045047666_1045047679

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1045047666 1045047679
Species Human (GRCh38) Human (GRCh38)
Location 8:98294388-98294410 8:98294432-98294454
Sequence CCAGCTCGCACCGCGCCCTCCTT CCTCGGGGCCGCACTGCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 211} {0: 1, 1: 0, 2: 1, 3: 60, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!