ID: 1045047673_1045047679

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1045047673 1045047679
Species Human (GRCh38) Human (GRCh38)
Location 8:98294411-98294433 8:98294432-98294454
Sequence CCGCTGGGCCAGTGTCTGCATCC CCTCGGGGCCGCACTGCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 237} {0: 1, 1: 0, 2: 1, 3: 60, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!