ID: 1045054901_1045054907

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1045054901 1045054907
Species Human (GRCh38) Human (GRCh38)
Location 8:98360381-98360403 8:98360410-98360432
Sequence CCTTCTTCCCTCTGTGTCTCCAT TCCAGTGCCTGTCATACTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 37, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!