ID: 1045096298_1045096305

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1045096298 1045096305
Species Human (GRCh38) Human (GRCh38)
Location 8:98801004-98801026 8:98801036-98801058
Sequence CCCGTGGCCCTGGCATGGGATTC AGCCAGCTGGGTTCCTGTGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 123, 3: 209, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!