ID: 1045130039_1045130044

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1045130039 1045130044
Species Human (GRCh38) Human (GRCh38)
Location 8:99140694-99140716 8:99140737-99140759
Sequence CCTCCTCCTCCTTCTCCTTCTTT TTTGTTTACAACTGAAACTCTGG
Strand - +
Off-target summary {0: 10, 1: 233, 2: 1551, 3: 5166, 4: 14896} {0: 2, 1: 7, 2: 9, 3: 17, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!