ID: 1045146277_1045146280

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1045146277 1045146280
Species Human (GRCh38) Human (GRCh38)
Location 8:99347836-99347858 8:99347860-99347882
Sequence CCATCTTCTAAAAGCCCACACTG AGTTCACATCTGCAGTTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 221} {0: 1, 1: 0, 2: 0, 3: 16, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!