ID: 1045184462_1045184465

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1045184462 1045184465
Species Human (GRCh38) Human (GRCh38)
Location 8:99823003-99823025 8:99823020-99823042
Sequence CCTTTGAAAACCAGTGTTCTGAT TCTGATACTATTAACTAGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!