ID: 1045231214_1045231218

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1045231214 1045231218
Species Human (GRCh38) Human (GRCh38)
Location 8:100309520-100309542 8:100309536-100309558
Sequence CCGTCATAATATCGCCGGGCCGG GGGCCGGCCGCCGGCCGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 9} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!