ID: 1045259464_1045259481

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1045259464 1045259481
Species Human (GRCh38) Human (GRCh38)
Location 8:100559588-100559610 8:100559629-100559651
Sequence CCGGGCACCCTCGCCCCTCAGGG GACCTCCAGTGCTACAGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 425} {0: 1, 1: 0, 2: 2, 3: 17, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!