ID: 1045277435_1045277439

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1045277435 1045277439
Species Human (GRCh38) Human (GRCh38)
Location 8:100721186-100721208 8:100721201-100721223
Sequence CCGGGCGTGTGGCTGCCGGCAGC CCGGCAGCGCGGGTCCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 164} {0: 1, 1: 0, 2: 2, 3: 22, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!