ID: 1045277739_1045277754

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1045277739 1045277754
Species Human (GRCh38) Human (GRCh38)
Location 8:100722349-100722371 8:100722382-100722404
Sequence CCCGCGCTGCGTCGCGTCCGTGG GACGGCTCGCGGGCGGTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41} {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!