ID: 1045278531_1045278534

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1045278531 1045278534
Species Human (GRCh38) Human (GRCh38)
Location 8:100728408-100728430 8:100728428-100728450
Sequence CCACTACTGGGAGGCTGAGGCAA CAAGAGGATCACTTGAGCCAGGG
Strand - +
Off-target summary No data {0: 22, 1: 881, 2: 10156, 3: 36785, 4: 141350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!