ID: 1045305856_1045305866

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1045305856 1045305866
Species Human (GRCh38) Human (GRCh38)
Location 8:100956146-100956168 8:100956180-100956202
Sequence CCAAGTGCAGTGGCTCACGCTTG CTGTGGGAGGGTGAGGTGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 21, 2: 1891, 3: 31203, 4: 92339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!